View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20618_high_63 (Length: 320)

Name: NF20618_high_63
Description: NF20618
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20618_high_63
NF20618_high_63
[»] chr7 (2 HSPs)
chr7 (18-320)||(38893170-38893472)
chr7 (18-320)||(38883978-38884280)
[»] chr1 (8 HSPs)
chr1 (202-305)||(33109254-33109357)
chr1 (191-314)||(33115278-33115401)
chr1 (166-275)||(30615900-30616009)
chr1 (160-257)||(30620669-30620766)
chr1 (229-263)||(9699528-9699562)
chr1 (205-275)||(16175135-16175205)
chr1 (205-275)||(16184157-16184227)
chr1 (205-275)||(16223547-16223617)


Alignment Details
Target: chr7 (Bit Score: 295; Significance: 1e-166; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 295; E-Value: 1e-166
Query Start/End: Original strand, 18 - 320
Target Start/End: Original strand, 38893170 - 38893472
Alignment:
18 attgccacccaatgtatcagctgcggttaatggggttgctttctgtggtacacttacagggcagcttttctttggctggcttggtgataagttgggtagg 117  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
38893170 attgccacccaatgtatcagctgcggttaatggggttgctttctgtggtacacttacagggcagcttttctttggctggcttggtgataagttgggtagg 38893269  T
118 aagaaagtgtatggtatgacactgatgataatggtaatctgctccattggttccggcctttcttttggacacaatccaaaaacggtcatggcaactcttt 217  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
38893270 aagaaagtgtatggtatgacactgatgataatggtaatctgctccattggttccggcctttcttttggacacaatccaaaaacggtcatggcaactcttt 38893369  T
218 gcttcttccgtttttggcttgggtttggtattggtggagactacccgctttcggctactgtaatgtcagagtattctaataagaagactcgtggtgcctt 317  Q
    |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||    
38893370 gcttcttccgtttttggcttgggtttggtattggtggagattacccgctttcggctactataatgtcagagtattctaataagaagactcgtggtgcctt 38893469  T
318 cat 320  Q
    |||    
38893470 cat 38893472  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 155; E-Value: 3e-82
Query Start/End: Original strand, 18 - 320
Target Start/End: Original strand, 38883978 - 38884280
Alignment:
18 attgccacccaatgtatcagctgcggttaatggggttgctttctgtggtacacttacagggcagcttttctttggctggcttggtgataagttgggtagg 117  Q
    |||||| ||||||||||||||||| || ||||| || ||||||||||| |||||| ||||||| ||||||||||||||||||||||||||| |||| |||    
38883978 attgcctcccaatgtatcagctgctgtgaatggtgtagctttctgtggaacactttcagggcaacttttctttggctggcttggtgataagatgggcagg 38884077  T
118 aagaaagtgtatggtatgacactgatgataatggtaatctgctccattggttccggcctttcttttggacacaatccaaaaacggtcatggcaactcttt 217  Q
    || ||||| ||||||||||| || ||||| ||||| ||||| || |||||||| || |||||||| ||||||| ||||||  | |||||| |||| ||||    
38884078 aaaaaagtctatggtatgaccctcatgatgatggttatctgttcaattggttctggtctttctttcggacacactccaaagtctgtcatgacaacccttt 38884177  T
218 gcttcttccgtttttggcttgggtttggtattggtggagactacccgctttcggctactgtaatgtcagagtattctaataagaagactcgtggtgcctt 317  Q
    |||||||||| || ||||||||||| ||||||||||| |||||||| |||||||||||  ||||||| |||||||||||||| ||||||||||| |||||    
38884178 gcttcttccggttctggcttgggttcggtattggtggtgactacccactttcggctaccataatgtcggagtattctaataaaaagactcgtggggcctt 38884277  T
318 cat 320  Q
    |||    
38884278 cat 38884280  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 36; Significance: 0.00000000003; HSPs: 8)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 202 - 305
Target Start/End: Original strand, 33109254 - 33109357
Alignment:
202 gtcatggcaactctttgcttcttccgtttttggcttgggtttggtattggtggagactacccgctttcggctactgtaatgtcagagtattctaataaga 301  Q
    ||||||||||| ||||| |||||| | ||||||||||| ||||| |||||||| || ||||| ||||| |||||  | ||||| |||||| | || ||||    
33109254 gtcatggcaacactttgtttcttcaggttttggcttggttttggaattggtggtgattaccctctttctgctacaattatgtctgagtatgcgaacaaga 33109353  T
302 agac 305  Q
    ||||    
33109354 agac 33109357  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 191 - 314
Target Start/End: Original strand, 33115278 - 33115401
Alignment:
191 atccaaaaacggtcatggcaactctttgcttcttccgtttttggcttgggtttggtattggtggagactacccgctttcggctactgtaatgtcagagta 290  Q
    |||| ||||| || ||||| || ||||| |||||| | || |||||||| ||||| ||||| || || ||||| ||||| |||||| | ||||| |||||    
33115278 atcccaaaactgttatggctaccctttgtttcttcaggttctggcttggatttggaattggcggtgattaccctctttcagctactatcatgtctgagta 33115377  T
291 ttctaataagaagactcgtggtgc 314  Q
    | | ||||| ||||||||||||||    
33115378 tgcaaataaaaagactcgtggtgc 33115401  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 166 - 275
Target Start/End: Complemental strand, 30616009 - 30615900
Alignment:
166 ggttccggcctttcttttggacacaatccaaaaacggtcatggcaactctttgcttcttccgtttttggcttgggtttggtattggtggagactacccgc 265  Q
    ||||| || ||||| ||||||||  | ||||||| |||  ||| |||||||||||||||| | || |||||||| |||||||||||||| || || || |    
30616009 ggttctggtctttcatttggacatgaaccaaaaatggtgttgggaactctttgcttcttcagattctggcttggttttggtattggtggtgattatccac 30615910  T
266 tttcggctac 275  Q
    |||| |||||    
30615909 tttctgctac 30615900  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #4
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 160 - 257
Target Start/End: Complemental strand, 30620766 - 30620669
Alignment:
160 tccattggttccggcctttcttttggacacaatccaaaaacggtcatggcaactctttgcttcttccgtttttggcttgggtttggtattggtggaga 257  Q
    ||||| ||||| || ||||| ||||||||  | |||||||| ||  ||| |||||||||||||||| | || |||||||| || ||||||||||||||    
30620766 tccataggttctggtctttcatttggacatgaaccaaaaacagtgttgggaactctttgcttcttcagattctggcttggtttcggtattggtggaga 30620669  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #5
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 229 - 263
Target Start/End: Complemental strand, 9699562 - 9699528
Alignment:
229 ttttggcttgggtttggtattggtggagactaccc 263  Q
    ||||||||||| |||||||||||||||||||||||    
9699562 ttttggcttggatttggtattggtggagactaccc 9699528  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #6
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 205 - 275
Target Start/End: Complemental strand, 16175205 - 16175135
Alignment:
205 atggcaactctttgcttcttccgtttttggcttgggtttggtattggtggagactacccgctttcggctac 275  Q
    |||||||| ||||| |||||  | ||||||||||| |||||||||||||| || ||||| ||||| |||||    
16175205 atggcaacactttgtttctttaggttttggcttggttttggtattggtggtgattaccctctttcagctac 16175135  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #7
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 205 - 275
Target Start/End: Original strand, 16184157 - 16184227
Alignment:
205 atggcaactctttgcttcttccgtttttggcttgggtttggtattggtggagactacccgctttcggctac 275  Q
    |||||||| ||||| |||||  | ||||||||||| |||||||||||||| || ||||| ||||| |||||    
16184157 atggcaacactttgtttctttaggttttggcttggttttggtattggtggtgattaccctctttcagctac 16184227  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #8
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 205 - 275
Target Start/End: Original strand, 16223547 - 16223617
Alignment:
205 atggcaactctttgcttcttccgtttttggcttgggtttggtattggtggagactacccgctttcggctac 275  Q
    |||||||| ||||| |||||  | ||||||||||| |||||||||||||| || ||||| ||||| |||||    
16223547 atggcaacactttgtttctttaggttttggcttggttttggtattggtggtgattaccctctttcagctac 16223617  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University