View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20618_high_84 (Length: 257)
Name: NF20618_high_84
Description: NF20618
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20618_high_84 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 237; Significance: 1e-131; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 237; E-Value: 1e-131
Query Start/End: Original strand, 1 - 249
Target Start/End: Original strand, 48393397 - 48393645
Alignment:
| Q |
1 |
catttcaaagcttgttaaaatcgctgggataacaattgctgcgtcgaggactaaggcaaaagcaacatatgtgaccttgatatgtaagaattgtaagaag |
100 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48393397 |
catttcgaagcttgttaaaatcgctgggataacaattgctgcgtcgaggactaaggcaaaagcaacatatgtgaccttgatatgtaagaattgtaagaag |
48393496 |
T |
|
| Q |
101 |
gggaagcaagttccgtgtcggccaggacttggtggagcagttgttccacgttcatgtgatcatgttcctcaggtttagtttgtactgtcttttgcttatt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48393497 |
gggaagcaagttccgtgtcggccaggacttggtggagcagttgttccacgttcatgtgatcatgttcctcaggtttagtttgtactgtcttttgcttatt |
48393596 |
T |
|
| Q |
201 |
ttgcagtggaaacttcaccgttctttattttgcgttttttgatgatgtc |
249 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||| |||||| |
|
|
| T |
48393597 |
ttgcagtggaaacttcaccgttctttattttgcattttttgaggatgtc |
48393645 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 49 - 183
Target Start/End: Original strand, 31937420 - 31937550
Alignment:
| Q |
49 |
gactaaggcaaaagcaacatatgtgaccttgatatgtaagaattgtaagaaggggaagcaagttccgtgtcggccaggacttggtggagcagttgttcca |
148 |
Q |
| |
|
||||||| |||| ||||||||||||||| |||| || ||||||| |||||||| ||||||| || |||||| | |||||||| |||| |||||||| |
|
|
| T |
31937420 |
gactaagacaaaggcaacatatgtgaccctgatttgcaagaattttaagaaggagaagcaaattatgtgtcgacagggacttgggcgagcggttgttcct |
31937519 |
T |
|
| Q |
149 |
cgttcatgtgatcatgttcctcaggtttagtttgt |
183 |
Q |
| |
|
||||| || |||||| |||| ||||||||||| |
|
|
| T |
31937520 |
cgttcgtg----catgtttctcaagtttagtttgt |
31937550 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University