View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20618_high_96 (Length: 225)
Name: NF20618_high_96
Description: NF20618
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20618_high_96 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 155; Significance: 2e-82; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 12 - 188
Target Start/End: Original strand, 3934654 - 3934827
Alignment:
| Q |
12 |
aggagcagagatggacttgtatcaccacggtggggatgggggatggagacgcacgccagcagggggcatgttgtaggagtagatgcaaatggtaaactaa |
111 |
Q |
| |
|
|||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3934654 |
aggatcagagatggacttgtatcaccaaggtggggatgggggatggagacgcacgccagcagggggcatgttgtaggagtagatgcaaatggtaaactaa |
3934753 |
T |
|
| Q |
112 |
gaataagatttcgatggagggaagggaggagaccttggataggagaccctgctgatattgctcttgatgagaactga |
188 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3934754 |
gaataagatttcgatggagggaag---ggagaccttggataggagaccctgctgatattgctcttgatgagaactga |
3934827 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University