View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20618_high_96 (Length: 225)

Name: NF20618_high_96
Description: NF20618
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20618_high_96
NF20618_high_96
[»] chr3 (1 HSPs)
chr3 (12-188)||(3934654-3934827)


Alignment Details
Target: chr3 (Bit Score: 155; Significance: 2e-82; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 12 - 188
Target Start/End: Original strand, 3934654 - 3934827
Alignment:
12 aggagcagagatggacttgtatcaccacggtggggatgggggatggagacgcacgccagcagggggcatgttgtaggagtagatgcaaatggtaaactaa 111  Q
    |||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
3934654 aggatcagagatggacttgtatcaccaaggtggggatgggggatggagacgcacgccagcagggggcatgttgtaggagtagatgcaaatggtaaactaa 3934753  T
112 gaataagatttcgatggagggaagggaggagaccttggataggagaccctgctgatattgctcttgatgagaactga 188  Q
    ||||||||||||||||||||||||   ||||||||||||||||||||||||||||||||||||||||||||||||||    
3934754 gaataagatttcgatggagggaag---ggagaccttggataggagaccctgctgatattgctcttgatgagaactga 3934827  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University