View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20618_high_97 (Length: 225)
Name: NF20618_high_97
Description: NF20618
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20618_high_97 |
 | |
|
| [»] chr7 (3 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 87; Significance: 7e-42; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 87; E-Value: 7e-42
Query Start/End: Original strand, 135 - 225
Target Start/End: Complemental strand, 33037135 - 33037045
Alignment:
| Q |
135 |
ccttttcaattgatcattcccttttcgagataactttttccactgcagttgtcatcaaaaatgcacttttttccattgtctttcaattttc |
225 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33037135 |
ccttttcaattgatcattcctttttcgagataactttttccactgcagttgtcatcaaaaatgcacttttttccattgtctttcaattttc |
33037045 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 5 - 50
Target Start/End: Complemental strand, 33037266 - 33037221
Alignment:
| Q |
5 |
tgtttatttaatatggtgttaaataggcgaagcacctaccattgta |
50 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| || |||||| |
|
|
| T |
33037266 |
tgtttatttaatatggtgttaaataggcgaagcacccacgattgta |
33037221 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 3 - 43
Target Start/End: Original strand, 28607051 - 28607091
Alignment:
| Q |
3 |
agtgtttatttaatatggtgttaaataggcgaagcacctac |
43 |
Q |
| |
|
||||| |||||| |||||||||||||||| ||||||||||| |
|
|
| T |
28607051 |
agtgtctatttagtatggtgttaaataggtgaagcacctac |
28607091 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 12 - 49
Target Start/End: Original strand, 6148485 - 6148522
Alignment:
| Q |
12 |
ttaatatggtgttaaataggcgaagcacctaccattgt |
49 |
Q |
| |
|
|||||||||||||||||||| |||||||| |||||||| |
|
|
| T |
6148485 |
ttaatatggtgttaaataggtgaagcacccaccattgt |
6148522 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 30; Significance: 0.00000008; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 4 - 49
Target Start/End: Original strand, 26952585 - 26952630
Alignment:
| Q |
4 |
gtgtttatttaatatggtgttaaataggcgaagcacctaccattgt |
49 |
Q |
| |
|
|||| |||||||||||||| |||||||| |||||||| |||||||| |
|
|
| T |
26952585 |
gtgtctatttaatatggtgctaaataggtgaagcacccaccattgt |
26952630 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 9 - 49
Target Start/End: Complemental strand, 51370352 - 51370312
Alignment:
| Q |
9 |
tatttaatatggtgttaaataggcgaagcacctaccattgt |
49 |
Q |
| |
|
||||||||||||| |||||||| ||||||||| |||||||| |
|
|
| T |
51370352 |
tatttaatatggtattaaatagacgaagcacccaccattgt |
51370312 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University