View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20618_high_98 (Length: 222)
Name: NF20618_high_98
Description: NF20618
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20618_high_98 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 19 - 209
Target Start/End: Complemental strand, 50439933 - 50439743
Alignment:
| Q |
19 |
ggtttcatcttattgcaataatctctccagcataggttacaacttatacgaaaacagtttaaccatattcactattttactatagaaataacttatacat |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50439933 |
ggtttcatcttattgcaataatctctccagcataggttacaacttatacgaaaacagtttaaccatattcactattttactatagaaataacttatacat |
50439834 |
T |
 |
| Q |
119 |
ttaacacttatatgagaacatgtatttaataaaattttaattaatctgtttatccaagtacaccctagttgacacgatctcctcacaggtt |
209 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
50439833 |
ttaacacttatatgagaaaatgtatttaataaaattttaattaatctgtttatccaaatacaccctagttgacacgatctcctcacaggtt |
50439743 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University