View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20618_low_110 (Length: 201)
Name: NF20618_low_110
Description: NF20618
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20618_low_110 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 77; Significance: 6e-36; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 77; E-Value: 6e-36
Query Start/End: Original strand, 104 - 184
Target Start/End: Original strand, 7858674 - 7858754
Alignment:
| Q |
104 |
ggaatgcaaccctcgagaatatcaataaatcttattttgaattatttaagtaatttcaagtgctgctttcatgaaattgat |
184 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7858674 |
ggaatgcaaccctcaagaatatcaataaatcttattttgaattatttaagtaatttcaagtgctgctttcatgaaattgat |
7858754 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 73; E-Value: 1e-33
Query Start/End: Original strand, 1 - 77
Target Start/End: Original strand, 7858571 - 7858647
Alignment:
| Q |
1 |
ccaatggtgcaaacactaaaccacatgaattgctcgagtgagttacactgtaacaatcacttaaagcatttgatcta |
77 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7858571 |
ccaatggtgcaaccactaaaccacatgaattgctcgagtgagttacactgtaacaatcacttaaagcatttgatcta |
7858647 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University