View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20618_low_110 (Length: 201)

Name: NF20618_low_110
Description: NF20618
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20618_low_110
NF20618_low_110
[»] chr1 (2 HSPs)
chr1 (104-184)||(7858674-7858754)
chr1 (1-77)||(7858571-7858647)


Alignment Details
Target: chr1 (Bit Score: 77; Significance: 6e-36; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 77; E-Value: 6e-36
Query Start/End: Original strand, 104 - 184
Target Start/End: Original strand, 7858674 - 7858754
Alignment:
104 ggaatgcaaccctcgagaatatcaataaatcttattttgaattatttaagtaatttcaagtgctgctttcatgaaattgat 184  Q
    |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
7858674 ggaatgcaaccctcaagaatatcaataaatcttattttgaattatttaagtaatttcaagtgctgctttcatgaaattgat 7858754  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 73; E-Value: 1e-33
Query Start/End: Original strand, 1 - 77
Target Start/End: Original strand, 7858571 - 7858647
Alignment:
1 ccaatggtgcaaacactaaaccacatgaattgctcgagtgagttacactgtaacaatcacttaaagcatttgatcta 77  Q
    |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
7858571 ccaatggtgcaaccactaaaccacatgaattgctcgagtgagttacactgtaacaatcacttaaagcatttgatcta 7858647  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University