View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20618_low_67 (Length: 314)
Name: NF20618_low_67
Description: NF20618
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20618_low_67 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 291; Significance: 1e-163; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 291; E-Value: 1e-163
Query Start/End: Original strand, 1 - 295
Target Start/End: Complemental strand, 15835999 - 15835705
Alignment:
| Q |
1 |
aacaatgtctttgtcgatcaaatggtggacaacttcaattctctgccaagtaaccgaaacccactgatggggttcaccgagaacatgtcaccgacatttc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15835999 |
aacaatgtctttgtcgatcaaatggtggacaacttcaattctctggcaagtaaccgaaacccactgatggggttcaccgagaacatgtcaccgacatttc |
15835900 |
T |
 |
| Q |
101 |
tctccaccggtaacccatgccttgatttcttcttccatgttgtccccgatactccctctgaaacacttgtcgagagactcaaactagcatggtcccataa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15835899 |
tctccaccggtaacccatgccttgatttcttcttccatgttgtccccgatactccctctgaaacacttgtcgagagactcaaactagcatggtcccataa |
15835800 |
T |
 |
| Q |
201 |
cccactcaccaccctcaaactcgtctgtaacctccgtggtgttcgtggtaccggcaagtccaataaagaaggcttctacgctgctgctctctggt |
295 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15835799 |
cccactcaccaccctcaaactcgtctgtaacctccgtggtgttcgtggtaccggcaagtccaataaagaaggcttctacgctgctgctctctggt |
15835705 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 159; Significance: 1e-84; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 159; E-Value: 1e-84
Query Start/End: Original strand, 5 - 295
Target Start/End: Complemental strand, 19796757 - 19796467
Alignment:
| Q |
5 |
atgtctttgtcgatcaaatggtggacaacttcaattctctgccaagtaaccgaaacccactgatggggttcaccgagaacatgtcaccgacatttctctc |
104 |
Q |
| |
|
||||||| ||||||||||||| | ||||||||||||||| || ||||||||||||| ||||||||| || |||||||||||||| || |||||||| |
|
|
| T |
19796757 |
atgtcttcctcgatcaaatggtcgccaacttcaattctcttggtagaaaccgaaacccaccgatggggttgacagagaacatgtcaccaacgtttctctc |
19796658 |
T |
 |
| Q |
105 |
caccggtaacccatgccttgatttcttcttccatgttgtccccgatactccctctgaaacacttgtcgagagactcaaactagcatggtcccataaccca |
204 |
Q |
| |
|
|||||||||||| ||||| |||||||||||||||||||| || |||||||| ||||||||||| || |||||||||||||| || |||||||| ||||| |
|
|
| T |
19796657 |
caccggtaacccttgcctcgatttcttcttccatgttgttcctgatactccttctgaaacactcgttgagagactcaaacttgcttggtcccaaaaccct |
19796558 |
T |
 |
| Q |
205 |
ctcaccaccctcaaactcgtctgtaacctccgtggtgttcgtggtaccggcaagtccaataaagaaggcttctacgctgctgctctctggt |
295 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||| || || |||||||| |||||||| ||||||||||||||||| || |||||||||| |
|
|
| T |
19796557 |
ctcaccgccctcaaactcgtctgtaacctccgtggcgtccgcggtaccggaaagtccaacaaagaaggcttctacgccgccgctctctggt |
19796467 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 86; Significance: 4e-41; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 86; E-Value: 4e-41
Query Start/End: Original strand, 82 - 295
Target Start/End: Complemental strand, 47713732 - 47713519
Alignment:
| Q |
82 |
aacatgtcaccgacatttctctccaccggtaacccatgccttgatttcttcttccatgttgtccccgatactccctctgaaacacttgtcgagagactca |
181 |
Q |
| |
|
||||||||||| |||| |||| | || || |||||||| ||||| ||||||||||||||||||||||| |||||| ||||||| || || |||| |
|
|
| T |
47713732 |
aacatgtcaccaacatatctcactactggcaacccatgtcttgacttcttcttccatgttgtccccgacactccccctgaaactctcctccgacgacttc |
47713633 |
T |
 |
| Q |
182 |
aactagcatggtcccataacccactcaccaccctcaaactcgtctgtaacctccgtggtgttcgtggtaccggcaagtccaataaagaaggcttctacgc |
281 |
Q |
| |
|
|| ||||||||||| ||||||||||||||||||| |||||||||||||||||||| || ||||| ||||||||||||||| || ||||| |||||||| |
|
|
| T |
47713632 |
aattagcatggtcctataacccactcaccacccttaaactcgtctgtaacctccgcggcgttcgcggtaccggcaagtccgatcgtgaaggtttctacgc |
47713533 |
T |
 |
| Q |
282 |
tgctgctctctggt |
295 |
Q |
| |
|
|||||||| |||| |
|
|
| T |
47713532 |
cgctgctctttggt |
47713519 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University