View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20618_low_75 (Length: 279)
Name: NF20618_low_75
Description: NF20618
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20618_low_75 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 17 - 273
Target Start/End: Complemental strand, 6261749 - 6261489
Alignment:
| Q |
17 |
attcccaacagtatctcaatctaagagtattgcttgattgtgaataattgtggttagggttttaaataatttgtgtgaaagagggaatttcaattcctta |
116 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6261749 |
attcccaacagtatctccatctaagagtattgctttattgtgaataattgtggttagggttttaaataatttgtgtgaaagagggaatttcaattcctta |
6261650 |
T |
 |
| Q |
117 |
tcacatcacttatgtataattatgatgtgtgtttgattgcttgcttgttaatatgacaataatgtaagtacttatgcttttatatatgcagtgttgtatt |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6261649 |
tcacatcacttatgtataattatgatgtgtgtttgattgcttgcttgttaatatgacaataatgtaagtacttatgcttttatatatgcagtgttgtatt |
6261550 |
T |
 |
| Q |
217 |
tatggtttgtaaggtggtggcccaaaac----atcttgtaaaatagtttatttcatctcac |
273 |
Q |
| |
|
|||||||||||||||||||||| ||||| |||||||||||||||||||||||| |||| |
|
|
| T |
6261549 |
tatggtttgtaaggtggtggcctaaaacatctatcttgtaaaatagtttatttcatgtcac |
6261489 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University