View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20618_low_76 (Length: 277)
Name: NF20618_low_76
Description: NF20618
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20618_low_76 |
 |  |
|
| [»] scaffold0060 (2 HSPs) |
 |  |  |
|
| [»] scaffold0158 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr8 (Bit Score: 100; Significance: 2e-49; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 100; E-Value: 2e-49
Query Start/End: Original strand, 85 - 200
Target Start/End: Complemental strand, 20808844 - 20808729
Alignment:
| Q |
85 |
tagtcccatgccataggtgactgacgaattcttaacttgtatggcaacattcttttatttacttttcgaaacatcgtgtttaaactctttaaacttcaca |
184 |
Q |
| |
|
|||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
20808844 |
tagtcccatgccataggtcactgatgaattcttaacttgtatggcaacattcttttatttactttatgaaacatcgtgtttaaactctttaaacttcaca |
20808745 |
T |
 |
| Q |
185 |
actaaaattgcattcg |
200 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
20808744 |
actaaaattgcattcg |
20808729 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 24 - 68
Target Start/End: Complemental strand, 20808990 - 20808946
Alignment:
| Q |
24 |
tgatggctcaatatataacgtatatttatagtcatggattttctc |
68 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
20808990 |
tgatggctcaatatatgacgtatatttatagtcatggattttctc |
20808946 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0060 (Bit Score: 93; Significance: 2e-45; HSPs: 2)
Name: scaffold0060
Description:
Target: scaffold0060; HSP #1
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 153 - 265
Target Start/End: Complemental strand, 36950 - 36838
Alignment:
| Q |
153 |
aaacatcgtgtttaaactctttaaacttcacaactaaaattgcattcgagtaaccgcattcatgttctgagtagtgttttcccattcatatacttgttac |
252 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||| |||||||| |||||||||||||||||||||||| ||||||| ||||||||||| |
|
|
| T |
36950 |
aaacatcgtgtttaaactctttaaacttcacaactaaagttgcatttgagtaaccacattcatgttctgagtagtgtttttccattcagatacttgttac |
36851 |
T |
 |
| Q |
253 |
tgtacttgatatt |
265 |
Q |
| |
|
||||||||||||| |
|
|
| T |
36850 |
tgtacttgatatt |
36838 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0060; HSP #2
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 22 - 83
Target Start/End: Complemental strand, 37994 - 37934
Alignment:
| Q |
22 |
actgatggctcaatatataacgtatatttatagtcatggattttctcatgaacttatccttt |
83 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||| |||| ||||||||| |
|
|
| T |
37994 |
actgatggctcaatatataacgtgtatttatagtcatggattttctcctgaa-ttatccttt |
37934 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0158 (Bit Score: 88; Significance: 2e-42; HSPs: 1)
Name: scaffold0158
Description:
Target: scaffold0158; HSP #1
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 85 - 200
Target Start/End: Complemental strand, 11991 - 11876
Alignment:
| Q |
85 |
tagtcccatgccataggtgactgacgaattcttaacttgtatggcaacattcttttatttacttttcgaaacatcgtgtttaaactctttaaacttcaca |
184 |
Q |
| |
|
|||||||||||||||||| ||||| ||||||||||||| |||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||| |
|
|
| T |
11991 |
tagtcccatgccataggtcactgatgaattcttaacttatatggcaacattcttttatttactttctgaaacattgtgtttaaactctttaaacttcaca |
11892 |
T |
 |
| Q |
185 |
actaaaattgcattcg |
200 |
Q |
| |
|
||||||||| |||||| |
|
|
| T |
11891 |
actaaaattccattcg |
11876 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University