View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20618_low_86 (Length: 257)
Name: NF20618_low_86
Description: NF20618
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20618_low_86 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 10 - 240
Target Start/End: Complemental strand, 38643386 - 38643151
Alignment:
| Q |
10 |
attattcttggggtgagttgagtgaaatgtgaataatggcaactagcagaggcaaactaacaactaagtactagcttttatgacaggctcagtggatgag |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38643386 |
attattcttggggtgagttgagtgaaatgtgaataatggcaactagcagaggcaaactaacaactaagtactagcttttatgacaggctcagtggatgag |
38643287 |
T |
|
| Q |
110 |
aatgtaggattcatatgctgccagctatggtaacatgtgatttatatttaagaagccttgtgtttctgttgaattactaaaatactactactcactattt |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
38643286 |
aatgtaggattcatatgctgccagctatggtaacatgtgatttatatttaagaagccttgtgtttttgttgaattactaaaatactactactcactattt |
38643187 |
T |
|
| Q |
210 |
catt-----tcatgtcggtttgtatttgtgttgtgt |
240 |
Q |
| |
|
|||| |||||||||||| |||||||||||||| |
|
|
| T |
38643186 |
catttcatttcatgtcggtttttatttgtgttgtgt |
38643151 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University