View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20618_low_89 (Length: 239)
Name: NF20618_low_89
Description: NF20618
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20618_low_89 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 174; Significance: 9e-94; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 174; E-Value: 9e-94
Query Start/End: Original strand, 18 - 230
Target Start/End: Complemental strand, 29729853 - 29729643
Alignment:
| Q |
18 |
attattattccaaatccaatccaattgtttacttaaagggtgctgcgagcaaattaaagaattccgacctccaattctctatgattttgctttagctaaa |
117 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||| || |||||||| | |
|
|
| T |
29729853 |
attattattccaaatccaatccaa--gtttacttaaatggtgctgcgagcaaattaaagatttccgacctccaattctctatgattctgatttagctata |
29729756 |
T |
|
| Q |
118 |
aggacatttttgttaagatatatatgctaattattattggcagtattagataaatattgattatgattatgattgatgtcttggcatgatttcttcccaa |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
29729755 |
aggacatttttgttaagatatatatgctaattatgattggcagtattagataaatattgattatgattatgattgatgtcttggcatgatttcttctcaa |
29729656 |
T |
|
| Q |
218 |
atgttgatgatgt |
230 |
Q |
| |
|
||||||||||||| |
|
|
| T |
29729655 |
atgttgatgatgt |
29729643 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University