View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20618_low_94 (Length: 235)
Name: NF20618_low_94
Description: NF20618
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20618_low_94 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 181; Significance: 6e-98; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 181; E-Value: 6e-98
Query Start/End: Original strand, 21 - 217
Target Start/End: Complemental strand, 47121556 - 47121360
Alignment:
| Q |
21 |
taatatctaccatacaatttatttatttatttatttctcttgggacacttgttaagttgttaacactattcacatgagattccccacattatttgttcat |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47121556 |
taatatctaccatacaatttatttatttatttatttctcttgagacacttgttaagttgttaacactattcacatgagattccccacattatttgttcat |
47121457 |
T |
|
| Q |
121 |
tgtctttttgtgcttattggtggagtgtgattgggtaattgggtatgtacaaacacatccaacaaggtcagttttcaagctccaacagcagtatatg |
217 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47121456 |
tgtctttttgtgcttattggtggagtgttattgggtagttgggtttgtacaaacacatccaacaaggtcagttttcaagctccaacagcagtatatg |
47121360 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University