View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20619_high_33 (Length: 275)
Name: NF20619_high_33
Description: NF20619
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20619_high_33 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 69; Significance: 5e-31; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 69; E-Value: 5e-31
Query Start/End: Original strand, 1 - 77
Target Start/End: Original strand, 21569787 - 21569863
Alignment:
| Q |
1 |
ttgatattttatattatggagaatccaattaatttgtgactaatgcaattcacatattgtattagaacttagaagac |
77 |
Q |
| |
|
||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21569787 |
ttgatattttatattgtggaaaatccaattaatttgtgactaatgcaattcacatattgtattagaacttagaagac |
21569863 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 57; E-Value: 7e-24
Query Start/End: Original strand, 116 - 260
Target Start/End: Original strand, 21569905 - 21570049
Alignment:
| Q |
116 |
aatggttcacatattatattagttgannnnnnnatgaaattttgttatctaaggtcataaaa-atggtttattagaaagaattgcaccagatgannnnnn |
214 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||| |
|
|
| T |
21569905 |
aatggttcacatattatattagttgatttttt-atgaaattttgttatctaaggtcataaaaaatggtttattagaaagaattgcaacagatgatttttt |
21570003 |
T |
 |
| Q |
215 |
nnnnnnnnnnnaaatatataagcaaaataattgtaattaaggagag |
260 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
21570004 |
gtttagtttttaaatatataagcaaaataattgtaattaaggagag |
21570049 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University