View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20619_high_44 (Length: 243)
Name: NF20619_high_44
Description: NF20619
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20619_high_44 |
 | |
|
| [»] chr7 (2 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 142; Significance: 1e-74; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 82 - 243
Target Start/End: Original strand, 2642991 - 2643152
Alignment:
| Q |
82 |
agagaaactaaactatctatattgggtctaagtactaaaaaatcagaaaagatgacccaagttattgcaagagttagcacatggcagccacaaataacag |
181 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||| |
|
|
| T |
2642991 |
agagaaactaaactatctatattgggtctaagtactaaaaaatcagaaaagatgacccaagttattgcaagagttagcacttggaagccacaaataacag |
2643090 |
T |
|
| Q |
182 |
catcaaggacatgctaaatgagatcataaaataagttaaatatggaaaggctcattttctgt |
243 |
Q |
| |
|
|||||| |||||||||||||||||||| || ||||||||||||||||||||||||||||||| |
|
|
| T |
2643091 |
catcaaagacatgctaaatgagatcattaagtaagttaaatatggaaaggctcattttctgt |
2643152 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 18 - 82
Target Start/End: Original strand, 2642472 - 2642536
Alignment:
| Q |
18 |
agatgtggtttgtagcgcaacttgaatgttggttggtgcatacgacggatgaatgttgtttgtca |
82 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||| || ||||||||||||||||||| |
|
|
| T |
2642472 |
agatgtggtatgtagcgcaacttgaatgttggttggtgcatatgatggatgaatgttgtttgtca |
2642536 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University