View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20619_low_36 (Length: 268)
Name: NF20619_low_36
Description: NF20619
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20619_low_36 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 11 - 254
Target Start/End: Complemental strand, 2839482 - 2839242
Alignment:
| Q |
11 |
cacagatgagttggtcaaagtcatattttttaagcatgtttagttgcatcacagctgtacaccaaattaataaatctaaagcacgttacatcacattact |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2839482 |
cacagatgagttggtcaaagtcatattttttaagcatgtttagttgcatcacagctgtacaccaaattaataaatctaaagcacgttacatcacattact |
2839383 |
T |
 |
| Q |
111 |
atacatacacttttaacaacaaaaaa-tattgtcttttaaggctttgttttccctaccaccattcaaagttgctgtacagagaaaaataaaaagagagga |
209 |
Q |
| |
|
||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2839382 |
ataca----cttttaacaacaaaaaaatattgtcttttaaggctttgttttccctaccaccattcaaagttgctgtacagagaaaaataaaaagagagga |
2839287 |
T |
 |
| Q |
210 |
aaaataccacactagaatgatatgagagttaaatggcagagactg |
254 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2839286 |
aaaataccacactagaatgatatgagagttaaatggcagagactg |
2839242 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University