View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20619_low_38 (Length: 256)
Name: NF20619_low_38
Description: NF20619
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20619_low_38 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 237; Significance: 1e-131; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 237; E-Value: 1e-131
Query Start/End: Original strand, 20 - 256
Target Start/End: Complemental strand, 27610769 - 27610533
Alignment:
| Q |
20 |
atctgcagatatttctctacaaaatgcaggtaattatataaaagaaaatgcaagatgatataatttcattgatgatgtagccaatcttttcataatgtca |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27610769 |
atctgcagatatttctctacaaaatgcaggtaattatataaaagaaaatgcaagatgatataatttcattgatgatgtagccaatcttttcataatgtca |
27610670 |
T |
 |
| Q |
120 |
tcatgatgaacaatcaaaatttagataaaattttcataatgtaaatcatgtttgttgtttcagagtacgttgaaggagcagctaaaatttccagtcccaa |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27610669 |
tcatgatgaacaatcaaaatttagataaaattttcataatgtaaatcatgtttgttgtttcagagtacgttgaaggagcagctaaaatttccagtcccaa |
27610570 |
T |
 |
| Q |
220 |
ggaaggctatcctccacaacatacaagtaaaaaattg |
256 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27610569 |
ggaaggctatcctccacaacatacaagtaaaaaattg |
27610533 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University