View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20619_low_46 (Length: 238)
Name: NF20619_low_46
Description: NF20619
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20619_low_46 |
 | |
|
| [»] scaffold0302 (2 HSPs) |
| | |
|
Alignment Details
Target: chr6 (Bit Score: 216; Significance: 1e-119; HSPs: 4)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 1 - 228
Target Start/End: Original strand, 1183170 - 1183397
Alignment:
| Q |
1 |
agggtcataaatggatggcaatagaatatctaggttttgatatagataatgtaggtctgctaagttctgtttttgcgcgcttcatgttgctgttggatgt |
100 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
1183170 |
agggtcataaacggatggcaatagaatatctaggttttgatatagataatgtaggtctgctaagttctgtttttgcgcgcttcatgttgctgttgaatgt |
1183269 |
T |
|
| Q |
101 |
gtttttagtgtcgagggagttttccttctggtggtcctatgcagtttgctggctgcagcatagttggtgttgatatttttgcatctgtcatgtgtgattg |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
1183270 |
gtttttagtgtcgagggagttttccttctggtggtcctatgcagtttgctggctgcagcatagttggggttgatatttttgcatctgtcatgtgtgattg |
1183369 |
T |
|
| Q |
201 |
tcttcttgagcgcttcgttttgtctctg |
228 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
1183370 |
tcttcttgagcgcttcgttttgtctctg |
1183397 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 114 - 195
Target Start/End: Original strand, 1194125 - 1194206
Alignment:
| Q |
114 |
agggagttttccttctggtggtcctatgcagtttgctggctgcagcatagttggtgttgatatttttgcatctgtcatgtgt |
195 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1194125 |
agggatttttccttctggtggtcctatgcagtttgctggctgcagcatagttggtgttgatatttttgcatctgtcatgtgt |
1194206 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 70 - 179
Target Start/End: Complemental strand, 1236479 - 1236369
Alignment:
| Q |
70 |
tttttgcgcgcttcatgttgctgttggatgtgtttttagtgt--cgagggagttttccttctggtggtcctatgcagtttgctggctgcagcatagttgg |
167 |
Q |
| |
|
|||||||| |||| |||||||||||| |||||||||||||| || ||||||||||||||||| |||||||||||||||||||| ||||||||| |||| |
|
|
| T |
1236479 |
tttttgcgagctttgtgttgctgttgggtgtgtttttagtgtgtcg-gggagttttccttctggcggtcctatgcagtttgctggttgcagcatatttgg |
1236381 |
T |
|
| Q |
168 |
tgttgatatttt |
179 |
Q |
| |
|
|||||||||||| |
|
|
| T |
1236380 |
tgttgatatttt |
1236369 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 11 - 75
Target Start/End: Complemental strand, 1236558 - 1236494
Alignment:
| Q |
11 |
atggatggcaatagaatatctaggttttgatatagataatgtaggtctgctaagttctgtttttg |
75 |
Q |
| |
|
||||||| |||| |||||||||||||||||| ||||||||| |||||||| |||||||||||||| |
|
|
| T |
1236558 |
atggatgacaattgaatatctaggttttgatgtagataatgcaggtctgcaaagttctgtttttg |
1236494 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0302 (Bit Score: 57; Significance: 6e-24; HSPs: 2)
Name: scaffold0302
Description:
Target: scaffold0302; HSP #1
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 70 - 201
Target Start/End: Original strand, 20426 - 20558
Alignment:
| Q |
70 |
tttttgcgcgcttcatgttgctgttggatgtgtttttagtgt-cgagggagttttccttctggtggtcctatgcagtttgctggctgcagcatagttggt |
168 |
Q |
| |
|
|||||| | ||||| ||||| |||||| |||||||||||||| | |||| ||||||||||||||||||||| |||||||||||| | | ||||||||| |
|
|
| T |
20426 |
tttttgtgtgcttcgtgttgttgttgggtgtgtttttagtgtgctggggatttttccttctggtggtcctatacagtttgctggcagtaacatagttgga |
20525 |
T |
|
| Q |
169 |
gttgatatttttgcatctgtcatgtgtgattgt |
201 |
Q |
| |
|
||||||||||| ||||||||||||| ||||| |
|
|
| T |
20526 |
gttgatattttgtgatctgtcatgtgttattgt |
20558 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0302; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 14 - 73
Target Start/End: Original strand, 20346 - 20405
Alignment:
| Q |
14 |
gatggcaatagaatatctaggttttgatatagataatgtaggtctgctaagttctgtttt |
73 |
Q |
| |
|
|||||||||||||||||||||||| || | ||||||| |||||||| ||||||||||| |
|
|
| T |
20346 |
gatggcaatagaatatctaggtttcaatgtggataatgcaggtctgccgagttctgtttt |
20405 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 45; Significance: 9e-17; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 115 - 195
Target Start/End: Original strand, 12857383 - 12857463
Alignment:
| Q |
115 |
gggagttttccttctggtggtcctatgcagtttgctggctgcagcatagttggtgttgatatttttgcatctgtcatgtgt |
195 |
Q |
| |
|
|||| |||||||||| ||||||||||||| ||||||| | ||||||||||||| ||||||||||| ||| |||||||||| |
|
|
| T |
12857383 |
gggatttttccttctagtggtcctatgcaatttgctgacagcagcatagttggagttgatattttgtcatatgtcatgtgt |
12857463 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 44; Significance: 4e-16; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 137 - 204
Target Start/End: Complemental strand, 20256510 - 20256443
Alignment:
| Q |
137 |
ctatgcagtttgctggctgcagcatagttggtgttgatatttttgcatctgtcatgtgtgattgtctt |
204 |
Q |
| |
|
|||||||||||| |||||||| ||||||||| ||||||||||| |||||||||||||| |||||||| |
|
|
| T |
20256510 |
ctatgcagtttgttggctgcaacatagttggagttgatattttgtcatctgtcatgtgttattgtctt |
20256443 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University