View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2061_high_11 (Length: 439)
Name: NF2061_high_11
Description: NF2061
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2061_high_11 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 426; Significance: 0; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 426; E-Value: 0
Query Start/End: Original strand, 1 - 434
Target Start/End: Complemental strand, 38042681 - 38042248
Alignment:
| Q |
1 |
accaccatcacaccaccgaaccagaacctcaactcgccgacattgccaccgcctttgcctccaaccgcttctttttctcctctcccggccgttccaactc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38042681 |
accaccatcacaccaccgaaccagaacctcaactcgccgacattgccaccgcctttgcctccaaccgcttctttttctcctctcccggccgttccaactc |
38042582 |
T |
 |
| Q |
101 |
catagttgaatcaaccccatcctcattctcctcttcctcatcattgttggtttccactgtgccagcaccggcaaatgattctaacaaaaagaagacagtt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38042581 |
catagttgaatcaaccccatcctcattctcctcttcctcatcattgttggtttccactgtgccagcaccggcaaatgattctaacaaaaagaagacagtt |
38042482 |
T |
 |
| Q |
201 |
ttcaacggaagtgtggcggtgccaacatattcaccggacccttacatggattttcgaaggtcaatgcaagagatggtggaagcgcaaccagagttgatga |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38042481 |
ttcaacggaagtgtggcggtgccaacatattcaccggacccttacatggattttcgaaggtcaatgcaagagatggtggaagcgcaaccagagttgatga |
38042382 |
T |
 |
| Q |
301 |
aggacgtgaagtccaattgggaaaccttacacgagcttcttcttagctatctcgctattaatcccaacaacactcacaagtttattctcgatgctttttc |
400 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38042381 |
aggacgtgaagtccaattgggaaaccttacacgagcttcttcttagctatctcgctattaatcccaacaacactcacaagtttattctcgatgctttttc |
38042282 |
T |
 |
| Q |
401 |
tgatcttattgttactcttatgtcctttgcttct |
434 |
Q |
| |
|
|||||||||||||||||| ||||||||| ||||| |
|
|
| T |
38042281 |
tgatcttattgttactctcatgtccttttcttct |
38042248 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 39; Significance: 0.0000000000007; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 201 - 299
Target Start/End: Original strand, 31980765 - 31980863
Alignment:
| Q |
201 |
ttcaacggaagtgtggcggtgccaacatattcaccggacccttacatggattttcgaaggtcaatgcaagagatggtggaagcgcaaccagagttgatg |
299 |
Q |
| |
|
||||| ||||||||||| || ||||| || || || || ||||| ||||||||| |||| || ||||||||||||||||| |||| ||| ||||||||| |
|
|
| T |
31980765 |
ttcaatggaagtgtggcagtaccaacctactcgcccgatccttatatggattttagaagatcgatgcaagagatggtggaggcgcgaccggagttgatg |
31980863 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University