View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2061_high_24 (Length: 343)
Name: NF2061_high_24
Description: NF2061
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2061_high_24 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 94 - 326
Target Start/End: Complemental strand, 41343407 - 41343180
Alignment:
| Q |
94 |
agctgggattacaccttttgtggtggcagggattgaatttagcaagagaattgtaagtcacnnnnnnnacttgattattgctatctcatctcataaatta |
193 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||| |
|
|
| T |
41343407 |
agctgggattacaccttttgtggtggcagggattgaatttagcaagagaattgtaagtcactttttttacttgattattgctatctcat-----aaatta |
41343313 |
T |
|
| Q |
194 |
tgaatctcattcttgtgtgttttttgtcttcaattttgaatatttgttacagattgctcaaaaaagatgtgagatgtgtggaggatcaggacttgttttt |
293 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41343312 |
tgaatctcattcttgtatgttttttgtcttcaattttgaatatttgttacagattgctcaaaaaagatgtgagatgtgtggaggatcaggacttgttttt |
41343213 |
T |
|
| Q |
294 |
agggataagaactattttcgttgtccagaatgt |
326 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
41343212 |
agggataagaactattttcgttgtccagaatgt |
41343180 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University