View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2061_high_34 (Length: 283)
Name: NF2061_high_34
Description: NF2061
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2061_high_34 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 243; Significance: 1e-135; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 243; E-Value: 1e-135
Query Start/End: Original strand, 18 - 275
Target Start/End: Complemental strand, 3119186 - 3118928
Alignment:
| Q |
18 |
gttagaaaattgggtttttt-gattcatttatggtttttctcccttattctgtgattgttgtgtgtttggcattcggtttattcttttattgatttcagg |
116 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3119186 |
gttagaaaattgggtttttttgattcatttatggtttttctcccttattctgtgattgttgtgtgtttggcattcggtttattcttttattgatttcagg |
3119087 |
T |
|
| Q |
117 |
tttcaattgttgaattatgaataaaggaaaagtctataagaaaagattggaaacttttattgagggtgataaaattactgagactagggttcaagatgta |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3119086 |
tttcaattgttgaattatgaataaaggaaaagtctataagaaaagattggaaacttttattgagggtgataaaattactgagactagggttcaagatgta |
3118987 |
T |
|
| Q |
217 |
gcttggctttgctcactttccgaatctgaaattgtaagtctctttttctcttttctctg |
275 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||| |
|
|
| T |
3118986 |
gcttggctttgctcactttccgaatctgaaattgtaagtttctttttctcctttctctg |
3118928 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University