View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2061_high_37 (Length: 267)
Name: NF2061_high_37
Description: NF2061
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2061_high_37 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 158; Significance: 4e-84; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 158; E-Value: 4e-84
Query Start/End: Original strand, 1 - 170
Target Start/End: Complemental strand, 43052622 - 43052453
Alignment:
| Q |
1 |
cataactctctcaagacctttgatgtccataatttgtaattattaatgaaaaacaacatctatgattaatttcttctaaatgttgtctcagagaggaatt |
100 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43052622 |
cataactctctcaagaccttttatgtccataatttgtaattattaatgaaaaacaacatctatgattaatttcttctaaatgttgtctcagagaggaatt |
43052523 |
T |
 |
| Q |
101 |
tctaaacgtggttggaggagggctactgaatactgatcattatgattaaattcccaacaactgcattaga |
170 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||| |
|
|
| T |
43052522 |
tctaaacgtggttggaggagggctactgaatactgatcattatgattaaattcctaacatctgcattaga |
43052453 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 217 - 255
Target Start/End: Complemental strand, 43052417 - 43052379
Alignment:
| Q |
217 |
cctaataataaatctccatggaacaagaaaatgcatttt |
255 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43052417 |
cctaataataaatctccatggaacaagaaaatgcatttt |
43052379 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University