View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2061_high_39 (Length: 253)
Name: NF2061_high_39
Description: NF2061
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2061_high_39 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 63 - 248
Target Start/End: Original strand, 40776202 - 40776387
Alignment:
| Q |
63 |
ctacgcgaatgtgttaacatcaaaatatagaatttcgaatcattgaggaaaatctcaatgcttaatcttattggtttttcgttgttgactatggattcgg |
162 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40776202 |
ctacgcgaatgtgttaacatcaaaatatagaatttcgaatcattgaggaaaatctcaatgcttaatcttattggtttttcgttgttgactatggattcgg |
40776301 |
T |
 |
| Q |
163 |
tgccttacaggggaatgcttcagacattcttcatactcaattatgtcttggtttgccaacttgtcattattcaaccctttgcttct |
248 |
Q |
| |
|
||||||| |||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
40776302 |
tgccttataggggattgcttcagacattcttcatactcaattatgttttggtttgccaacttgtcattattcaaccctttgtttct |
40776387 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University