View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2061_high_43 (Length: 249)
Name: NF2061_high_43
Description: NF2061
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2061_high_43 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 235; Significance: 1e-130; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 11 - 249
Target Start/End: Complemental strand, 14022013 - 14021775
Alignment:
| Q |
11 |
cataggtggtgttgttggaaatggtaaagcaaggtatagagagtgtctgaagaatcatgctgtaggtattggtggtcatgctcttgatggttgcggtgag |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
14022013 |
cataggtggtgttgttggaaatggtaaagcaaggtatagagagtgtctgaagaatcatgctgtaggtattgggggtcatgctcttgatggttgcggtgag |
14021914 |
T |
 |
| Q |
111 |
tttatgccggcaggaagtgaaggaactttggagtcactaaaatgtgctgcttgtaactgccaccgtaacttccaccgaaaagagtcatcggcagatgtta |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14021913 |
tttatgccggcaggaagtgaaggaactttggagtcactaaaatgtgctgcttgtaactgccaccgtaacttccaccgaaaagagtcatcggcagatgtta |
14021814 |
T |
 |
| Q |
211 |
ctgccggtgacccttttctgttgacacaccatcatcacc |
249 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14021813 |
ctgccggtgacccttttctgttgacacaccatcatcacc |
14021775 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 148 - 187
Target Start/End: Complemental strand, 2494714 - 2494675
Alignment:
| Q |
148 |
taaaatgtgctgcttgtaactgccaccgtaacttccaccg |
187 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
2494714 |
taaaatgtgctgcttgtggctgccaccgtaacttccaccg |
2494675 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University