View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2061_high_45 (Length: 248)

Name: NF2061_high_45
Description: NF2061
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2061_high_45
NF2061_high_45
[»] chr7 (1 HSPs)
chr7 (17-99)||(40775009-40775091)


Alignment Details
Target: chr7 (Bit Score: 59; Significance: 4e-25; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 17 - 99
Target Start/End: Original strand, 40775009 - 40775091
Alignment:
17 acttaaatggtagccacatgaacattgatacattggagcacgagtttgaaaatgtgattatccgtttttccgcttttcaacat 99  Q
    |||||||||||||||||||||||||| |||||||  || ||||| | ||||||||||||||||||||||||||||||||||||    
40775009 acttaaatggtagccacatgaacatttatacattaaagtacgagctcgaaaatgtgattatccgtttttccgcttttcaacat 40775091  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University