View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2061_high_52 (Length: 239)
Name: NF2061_high_52
Description: NF2061
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2061_high_52 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 20 - 218
Target Start/End: Original strand, 55173236 - 55173434
Alignment:
| Q |
20 |
gcaactgagaaggcaatatcttcagcagatctctgtgatactggatcaccaaatactctgtactgagcggtccaattttcagtccatagggaaggcttgt |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55173236 |
gcaactgagaaggcaatatcttcagcagatctctgtgatactggatcaccaaatactctgtactgagcggtccaattttcagtccatagggaaggcttgt |
55173335 |
T |
 |
| Q |
120 |
atggtttgtttggtcctgagaaggtatcaccacaatgtcttccattgcatgcattgatctgccaaataaaattattaaactcatgatcacatcatgact |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55173336 |
atggtttgtttggtcctgagaaggtatcaccacaatgtcttccattgcatgcattgatctgccaaataaaattattaaactcatgatcacatcatgact |
55173434 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 61; Significance: 3e-26; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 80 - 184
Target Start/End: Complemental strand, 27721690 - 27721586
Alignment:
| Q |
80 |
tactgagcggtccaattttcagtccatagggaaggcttgtatggtttgtttggtcctgagaaggtatcaccacaatgtcttccattgcatgcattgatct |
179 |
Q |
| |
|
|||||||| ||||| ||||||||||||| | |||| ||||||||||||||||| |||| |||||||||||||| || ||||||||||||||||| |||| |
|
|
| T |
27721690 |
tactgagcagtccagttttcagtccatatgaaaggtttgtatggtttgtttggacctgtaaaggtatcaccacagtgccttccattgcatgcattaatct |
27721591 |
T |
 |
| Q |
180 |
gccaa |
184 |
Q |
| |
|
||||| |
|
|
| T |
27721590 |
gccaa |
27721586 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 20 - 78
Target Start/End: Complemental strand, 27721968 - 27721910
Alignment:
| Q |
20 |
gcaactgagaaggcaatatcttcagcagatctctgtgatactggatcaccaaatactct |
78 |
Q |
| |
|
||||||||||||||||| ||||| |||||||| || ||| |||||| ||||||||||| |
|
|
| T |
27721968 |
gcaactgagaaggcaatgtcttctgcagatctttgagatggtggatctccaaatactct |
27721910 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University