View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2061_high_53 (Length: 238)
Name: NF2061_high_53
Description: NF2061
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2061_high_53 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 174; Significance: 9e-94; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 174; E-Value: 9e-94
Query Start/End: Original strand, 18 - 191
Target Start/End: Original strand, 45541674 - 45541847
Alignment:
| Q |
18 |
gatcagacacaaaagtcaaacacagacgcacctccaaatagatggctaagctgcttttcgtgttgtacattttgtcactagcactcgcagggtgatcatc |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45541674 |
gatcagacacaaaagtcaaacacagacgcacctccaaatagatggctaagctgcttttcgtgttgtacattttgtcactagcactcgcagggtgatcatc |
45541773 |
T |
 |
| Q |
118 |
aagtagggtcttttgccaagccaacttccatttttattgtattatatacatgtgcattacaaagtagatttagt |
191 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45541774 |
aagtagggtcttttgccaagccaacttccatttttattgtattatatacatgtgcattacaaagtagatttagt |
45541847 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 190 - 224
Target Start/End: Original strand, 45541952 - 45541986
Alignment:
| Q |
190 |
gttagagtaattgtactttcaacatgttagcaaat |
224 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
45541952 |
gttagagtaattgtactttcaacatgttagcaaat |
45541986 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University