View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2061_low_37 (Length: 280)
Name: NF2061_low_37
Description: NF2061
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2061_low_37 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 15 - 265
Target Start/End: Original strand, 32862097 - 32862347
Alignment:
| Q |
15 |
gggacaatgataggtgctaactgggtgttggaggattattgtcgcgaaggtccgcgtaatgttgtcataactggaaggtacattcactcaatgatagtat |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||| |
|
|
| T |
32862097 |
gggacaatgataggtgctaactgggtgttggaggattattgtcgcgaaggtccgcgtaatgttgtcataactggaaggtacgttcactcactgatagtat |
32862196 |
T |
|
| Q |
115 |
tctagaaattgatttccaacatttttagctttatttggatgcatgtttnnnnnnnnttaatgttgacattgctttatttgagtgcagtacgaggggattg |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
32862197 |
tctagaaattgatttccaacatttttagctttatttggatgcatgtttaaaaaaaattaatgctgacattgctttatttgtgtgcagtacgaggggattg |
32862296 |
T |
|
| Q |
215 |
gggaaagctttggcgcgggagtttcttctttcgggagatcgtgtgattgtt |
265 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32862297 |
gggaaagctttggcgcgggagtttcttctttcgggagatcgtgtgattgtt |
32862347 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University