View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2061_low_39 (Length: 265)
Name: NF2061_low_39
Description: NF2061
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2061_low_39 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 225; Significance: 1e-124; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 14 - 250
Target Start/End: Complemental strand, 29947531 - 29947295
Alignment:
| Q |
14 |
agacgaaggccgttgtggcgacctatgtcgacgcaaaacgcagctaccggcggcgacaattcagcgaaggcagtagtcgccgagcaaatctcacagacag |
113 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29947531 |
agacgaaggccgctgtggcgacctatgtcgacgcaaaacgcagctaccggcggcgacaattcagcgaaggcagtagtcgccgagcaaatctcacagacag |
29947432 |
T |
 |
| Q |
114 |
tgcaatcaacatcaaaccttcttcacctcatgcaaaactcttctcctgctcaggtactttcttctcttcctcaatatcattcataattcaaattcaacat |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29947431 |
tgcaatcaacatcaaaccttcttcacctcatgcaacactcttctcctgctcaggtactttcttctcttcctcaatatcattcataattcaaattcaacat |
29947332 |
T |
 |
| Q |
214 |
caaaatgaatagaaaattagaaaattgattttgtttc |
250 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||| |
|
|
| T |
29947331 |
caaaatgaatagaaaattggaaaattgattttgtttc |
29947295 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University