View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2061_low_40 (Length: 253)

Name: NF2061_low_40
Description: NF2061
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2061_low_40
NF2061_low_40
[»] chr7 (1 HSPs)
chr7 (63-248)||(40776202-40776387)


Alignment Details
Target: chr7 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 63 - 248
Target Start/End: Original strand, 40776202 - 40776387
Alignment:
63 ctacgcgaatgtgttaacatcaaaatatagaatttcgaatcattgaggaaaatctcaatgcttaatcttattggtttttcgttgttgactatggattcgg 162  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
40776202 ctacgcgaatgtgttaacatcaaaatatagaatttcgaatcattgaggaaaatctcaatgcttaatcttattggtttttcgttgttgactatggattcgg 40776301  T
163 tgccttacaggggaatgcttcagacattcttcatactcaattatgtcttggtttgccaacttgtcattattcaaccctttgcttct 248  Q
    ||||||| |||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||    
40776302 tgccttataggggattgcttcagacattcttcatactcaattatgttttggtttgccaacttgtcattattcaaccctttgtttct 40776387  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University