View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2061_low_53 (Length: 240)
Name: NF2061_low_53
Description: NF2061
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2061_low_53 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 20 - 240
Target Start/End: Original strand, 40811526 - 40811750
Alignment:
| Q |
20 |
atgaggtacggtaagcacaaggacccattaccactggtgcagagatctctgcttactcagtgttgtttgttggta--ctattatctctatgacttcaaac |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
40811526 |
atgaggtacggtaagcacaaggacccattaccactggtgcagagatctctgcttactcagtgttgtttgttggtactctattatctctatgacttcaaac |
40811625 |
T |
 |
| Q |
118 |
tctaatcaataatggtgtgtggaa---cttgatccttttcaatttttgataattgaacttgtaaaagtcactttggtcactcttcatagccacacacatg |
214 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
40811626 |
tctaatcaataatggtgtgtggaacttcttgatccttttcaa-ttttgataattgaacttgtaaaagtcactttggtcactcttcatagccacacacttg |
40811724 |
T |
 |
| Q |
215 |
gtatcaatgacgtggatgaatctctc |
240 |
Q |
| |
|
|| ||||||||||||||||||||||| |
|
|
| T |
40811725 |
gtgtcaatgacgtggatgaatctctc |
40811750 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University