View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20620_high_31 (Length: 403)
Name: NF20620_high_31
Description: NF20620
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20620_high_31 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 42; Significance: 0.00000000000001; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 217 - 269
Target Start/End: Complemental strand, 42017899 - 42017846
Alignment:
| Q |
217 |
aatgttatgatcgttcttgct-tgttcattgttattttcttttaatagtggata |
269 |
Q |
| |
|
|||||||||||| |||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
42017899 |
aatgttatgatcattcttgctatgttcattgttattttcttttaatagtggata |
42017846 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 32 - 68
Target Start/End: Complemental strand, 42018098 - 42018062
Alignment:
| Q |
32 |
caacactttgttcattgtatcatcggaagtttgagag |
68 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42018098 |
caacactttgttcattgtatcatcggaagtttgagag |
42018062 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University