View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20620_high_40 (Length: 371)
Name: NF20620_high_40
Description: NF20620
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20620_high_40 |
 | |
|
| [»] scaffold0565 (2 HSPs) |
| | |
|
| [»] scaffold0808 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0565 (Bit Score: 142; Significance: 2e-74; HSPs: 2)
Name: scaffold0565
Description:
Target: scaffold0565; HSP #1
Raw Score: 142; E-Value: 2e-74
Query Start/End: Original strand, 13 - 166
Target Start/End: Complemental strand, 4350 - 4197
Alignment:
| Q |
13 |
aatatgctaatgtccttcttcaagcatatgctcagcaacttagggtcagactctttttctatatgcattatatgagttagaatccgttaacactagggtt |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
4350 |
aatatgctaatgtccttcttcaagcatatgctcagcaactcagggtcagactctttttctatatgcattatataagttagaatccgttaacactagggtt |
4251 |
T |
|
| Q |
113 |
acatcaaatatcaaccgttataatgaattgatctaatggctcatattatgtcac |
166 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4250 |
acaccaaatatcaaccgttataatgaattgatctaatggctcatattatgtcac |
4197 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0565; HSP #2
Raw Score: 137; E-Value: 2e-71
Query Start/End: Original strand, 213 - 353
Target Start/End: Complemental strand, 4195 - 4055
Alignment:
| Q |
213 |
ttcaatttttgtgtttgtgattcagattttatataattatggggcaaggaaaatggcgttatttggagttggtcaaataggttgcaccccaaatgcattg |
312 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4195 |
ttcaatttttgtgtttgtaattcagattttatataattatggggcaaggaaaatggcgttatttggagttggtcaaataggttgcaccccaaatgcattg |
4096 |
T |
|
| Q |
313 |
gcccaaaacagcccagatggtagaacatgtgtagcaagaat |
353 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4095 |
gcccaaaacagcccagatggtagaacatgtgtagcaagaat |
4055 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 59; Significance: 6e-25; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 59; E-Value: 6e-25
Query Start/End: Original strand, 216 - 334
Target Start/End: Original strand, 7615647 - 7615765
Alignment:
| Q |
216 |
aatttttgtgtttgtgattcagattttatataattatggggcaaggaaaatggcgttatttggagttggtcaaataggttgcaccccaaatgcattggcc |
315 |
Q |
| |
|
|||| |||||||||||| | ||||||| ||||| ||||| |||||||||||||| |||||||| |||||||||||||||||| ||||||| ||| || |
|
|
| T |
7615647 |
aattgttgtgtttgtgacttagattttgtataactatggagcaaggaaaatggctttatttgggattggtcaaataggttgcagtccaaatgaattagct |
7615746 |
T |
|
| Q |
316 |
caaaacagcccagatggta |
334 |
Q |
| |
|
|||||||| |||||||||| |
|
|
| T |
7615747 |
caaaacagtccagatggta |
7615765 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 220 - 314
Target Start/End: Complemental strand, 36362007 - 36361913
Alignment:
| Q |
220 |
tttgtgtttgtgattcagattttatataattatggggcaaggaaaatggcgttatttggagttggtcaaataggttgcaccccaaatgcattggc |
314 |
Q |
| |
|
||||| ||||||||||||| | | ||||| | || ||||||||||||| ||||||| ||||||||||||| |||| |||||||| |||||| |
|
|
| T |
36362007 |
tttgtatttgtgattcagactctttataacaacggagcaaggaaaatggtactatttgggattggtcaaataggctgcagcccaaatgaattggc |
36361913 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 111 - 165
Target Start/End: Complemental strand, 21723432 - 21723378
Alignment:
| Q |
111 |
ttacatcaaatatcaaccgttataatgaattgatctaatggctcatattatgtca |
165 |
Q |
| |
|
||||||||||| ||||||||| |||| ||||||||||| | ||||||||||||| |
|
|
| T |
21723432 |
ttacatcaaatctcaaccgttgtaattaattgatctaagagttcatattatgtca |
21723378 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 122 - 159
Target Start/End: Complemental strand, 1614469 - 1614432
Alignment:
| Q |
122 |
atcaaccgttataatgaattgatctaatggctcatatt |
159 |
Q |
| |
|
||||||||||||||| |||||||| ||||||||||||| |
|
|
| T |
1614469 |
atcaaccgttataattaattgatccaatggctcatatt |
1614432 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0808 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: scaffold0808
Description:
Target: scaffold0808; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 111 - 163
Target Start/End: Complemental strand, 5064 - 5012
Alignment:
| Q |
111 |
ttacatcaaatatcaaccgttataatgaattgatctaatggctcatattatgt |
163 |
Q |
| |
|
||||| ||||| | |||||||||||| | ||||||||||| |||||||||||| |
|
|
| T |
5064 |
ttacaccaaatcttaaccgttataattatttgatctaatgactcatattatgt |
5012 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University