View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20620_high_57 (Length: 287)
Name: NF20620_high_57
Description: NF20620
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20620_high_57 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 188; Significance: 1e-102; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 18 - 257
Target Start/End: Complemental strand, 26880993 - 26880754
Alignment:
| Q |
18 |
attagttccgtgaaagctgtgcaactctgtgatcgtaacttcagtgttggtgctgatggagttatatttgtcttgcctggtatcaatggcactgactata |
117 |
Q |
| |
|
|||||||||| ||||| |||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26880993 |
attagttccgagaaagttgtgcaactctgtgatcgtaacttcagtgttggtgcagatgaagttatatttgtcttgcctggtatcaatggcactgactata |
26880894 |
T |
|
| Q |
118 |
cgatgaggattttcaaccctgatggtagtgagccttaggtgattaattgttcttaaaattatatttgttcaggtacgtgtcgtaattggttcttggtctt |
217 |
Q |
| |
|
| ||||||||||||||| ||||||||||||||||| |||||||||||| ||||||||||| ||| ||||||||||||| |||| ||| |||||||||||| |
|
|
| T |
26880893 |
caatgaggattttcaactctgatggtagtgagcctgaggtgattaattcttcttaaaattgtatgtgttcaggtacgtatcgtgatttgttcttggtctt |
26880794 |
T |
|
| Q |
218 |
cattaactgacaagtttgctttgtttcttacattcatgca |
257 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26880793 |
cattaactgacaagtttgctttgtttcttacattcatgca |
26880754 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 84; E-Value: 6e-40
Query Start/End: Original strand, 18 - 157
Target Start/End: Complemental strand, 40252603 - 40252464
Alignment:
| Q |
18 |
attagttccgtgaaagctgtgcaactctgtgatcgtaacttcagtgttggtgctgatggagttatatttgtcttgcctggtatcaatggcactgactata |
117 |
Q |
| |
|
|||||||| | ||||||||| ||||| |||||||||||||| |||||||||||||||||||||| ||||| |||||||||||| |||| ||||| |||| |
|
|
| T |
40252603 |
attagttcagagaaagctgtacaactatgtgatcgtaactttggtgttggtgctgatggagttatctttgtattgcctggtatcgatggtactgattata |
40252504 |
T |
|
| Q |
118 |
cgatgaggattttcaaccctgatggtagtgagccttaggt |
157 |
Q |
| |
|
| ||||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
40252503 |
caatgaggattttcaactctgatggtagtgagcctgaggt |
40252464 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University