View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20620_high_64 (Length: 264)
Name: NF20620_high_64
Description: NF20620
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20620_high_64 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 173; Significance: 4e-93; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 7 - 264
Target Start/End: Original strand, 46735663 - 46735922
Alignment:
| Q |
7 |
gtgagatgaagaaaaaatttaagcnnnnnnnnntatatataaaagtcttgtattggcgccagctattgtcattatgttcatagttttattcnnnnnnngc |
106 |
Q |
| |
|
|||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
46735663 |
gtgaaatgaagaaaaaatttaagcaaaaaaacatatatataaaagtcttgtattggcgccagctattgtcattatgttcatagttttattctttttttgc |
46735762 |
T |
 |
| Q |
107 |
tataataaaatgcatagctttcgtttctagtctagaataattgaataattgaattcaatttctatatttgttttgaccaataattccaaaacttcttttc |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46735763 |
tataataaaatgcatagctttcgtttctagtctagaataattgaataattgaattcaatttctatatttgttttgaccaataattccaaaacttcttttc |
46735862 |
T |
 |
| Q |
207 |
agcgtactctccatttg--nnnnnnnnaatcaaaagatagatgcatgctttttagtggtc |
264 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
46735863 |
agcgtactctccatttgttttttttttaatcaaaagatagatgcatgctttttagtggtc |
46735922 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University