View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20620_high_65 (Length: 263)
Name: NF20620_high_65
Description: NF20620
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20620_high_65 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 167; Significance: 2e-89; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 167; E-Value: 2e-89
Query Start/End: Original strand, 11 - 219
Target Start/End: Complemental strand, 30277944 - 30277736
Alignment:
| Q |
11 |
cagagaattggattccatgcagatatattgattcctgaggtgtgacacgatcgagtatgtcttagtgcatgcaaatgtgtggttgttattgccaccttgt |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30277944 |
cagagaattggattccatgcagatatattgattcctgaggtgtgacacgatcgagtatgtcttagtgcatgcaaatgtgtggttgttattgccaccttgt |
30277845 |
T |
 |
| Q |
111 |
gatatttgtggtcagcaannnnnnnatgtgcggaataaattaagaatgaggtgcagctagctacacaatagtactccactaagagnnnnnnnaatcatct |
210 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
30277844 |
gatatttgtggtcagcaatttttttatgtgcggaataaattaagaatgaggtgcagctagctacacaatagtactccactaagagtttttttaatcatct |
30277745 |
T |
 |
| Q |
211 |
tatagatat |
219 |
Q |
| |
|
||||||||| |
|
|
| T |
30277744 |
tatagatat |
30277736 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University