View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20620_high_76 (Length: 247)
Name: NF20620_high_76
Description: NF20620
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20620_high_76 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 231; Significance: 1e-128; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 231; E-Value: 1e-128
Query Start/End: Original strand, 1 - 231
Target Start/End: Original strand, 2093353 - 2093583
Alignment:
| Q |
1 |
gaattctaccattggagaatcttccagtgggttgatgagtgtcaaagtctctgccataaggaagacgatcggcgcgagcaaaggtagcaagaaaattgtt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2093353 |
gaattctaccattggagaatcttccagtgggttgatgagtgtcaaagtctctgccataaggaagacgatcggcgcgagcaaaggtagcaagaaaattgtt |
2093452 |
T |
 |
| Q |
101 |
ggtaccggaatcaacggaggagtcaccgatgacgaacaatgcaggagctagaggtggaggagaaggagaaggaggaatagcgggttgtggttgtggttgt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2093453 |
ggtaccggaatcaacggaggagtcaccgatgacgaacaatgcaggagctagaggtggaggagaaggagaaggaggaatagcgggttgtggttgtggttgt |
2093552 |
T |
 |
| Q |
201 |
gcagttgagggaccgcataagaagatgaaag |
231 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
2093553 |
gcagttgagggaccgcataagaagatgaaag |
2093583 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University