View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20620_high_78 (Length: 243)
Name: NF20620_high_78
Description: NF20620
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20620_high_78 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 18 - 224
Target Start/End: Complemental strand, 24568395 - 24568189
Alignment:
| Q |
18 |
cataggggctaaagcatattctaactttgaatatcgcaaacttttgcacaatttggaattataatataattgcagataccagatagaatatgtgaaggac |
117 |
Q |
| |
|
||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24568395 |
cataggggctaaagcatattctacctttgaatattgcaaacttttgcacaatttggaattataatataattgcagataccagatagaatatgtgaaggac |
24568296 |
T |
|
| Q |
118 |
ggtttgcactcattagaaggccttaattgttcgatattggtgtcttccctttcacacggttgtggtcccttatttgttgggcatgatcatatattacatg |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24568295 |
ggtttgcactcattagaaggccttaattgttcgatattggtgtcttctctttcacacggttgtggtcccttatttgttgggcatgatcatatattacatg |
24568196 |
T |
|
| Q |
218 |
ttcattc |
224 |
Q |
| |
|
||||||| |
|
|
| T |
24568195 |
ttcattc |
24568189 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University