View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20620_high_80 (Length: 241)
Name: NF20620_high_80
Description: NF20620
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20620_high_80 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 16 - 241
Target Start/End: Complemental strand, 36571034 - 36570810
Alignment:
| Q |
16 |
ctatatagggagcagttatgatagcgttacatttgataattgtgagtacttaagtttcatcaatatttgggcatgtagtttgatgtcacatgtaatgacc |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
36571034 |
ctatatagggagcagttatgatagcgttacatttgataattgtgagttcttaagtttcatcaatatttggg-atgtagtttgatgtcacatgtaatgacc |
36570936 |
T |
 |
| Q |
116 |
attccttatataggaaataattgtttactatcccttagtagtttgcatttatgagtaccaaaaatgcgtagtagagtnnnnnnngatatgtaactgaaat |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
36570935 |
attccttatataggaaataattgtttactatcccttagtagtttgcatttatgagtaccaaaaatgcgtagtagagtaaaaaaagatatgtaactgaaat |
36570836 |
T |
 |
| Q |
216 |
cagtgacaaaaaattctccaatcctc |
241 |
Q |
| |
|
||||||||||||||||||||| |||| |
|
|
| T |
36570835 |
cagtgacaaaaaattctccaaccctc |
36570810 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University