View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20620_high_83 (Length: 238)
Name: NF20620_high_83
Description: NF20620
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20620_high_83 |
 |  |
|
| [»] chr1 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 209; Significance: 1e-114; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 18 - 238
Target Start/End: Complemental strand, 39559374 - 39559154
Alignment:
| Q |
18 |
cataggtctcatgccttggcttgaatggaaccttagcaacgaagatattggaaatatgccatggagttgggtgaccttatttggagtttctatcaatact |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39559374 |
cataggtctcatgccttggcttgaatggaaccttagcaacgaagatattggaaatatgtcatggagttgggtgaccttatttggagtttctatcaatact |
39559275 |
T |
 |
| Q |
118 |
ttatccaaggatcataacgaactggtatttgaccagtactttaatctctggcaaaattggctcctccatatagctaatcaagtgcaaatggttgtcgaga |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
39559274 |
ttatccaaggatcataacgaactggtatttgaccagtactttaatctatggcaaaattggctcctccatatagctaatcaagtgcaaatggttgttgaga |
39559175 |
T |
 |
| Q |
218 |
atagctttaaacccgccgctt |
238 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
39559174 |
atagctttaaacccgccgctt |
39559154 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 20 - 72
Target Start/End: Complemental strand, 50439648 - 50439596
Alignment:
| Q |
20 |
taggtctcatgccttggcttgaatggaaccttagcaacgaagatattggaaat |
72 |
Q |
| |
|
||||| |||||||||||||||||||||||||| | |||| |||||||||||| |
|
|
| T |
50439648 |
taggtttcatgccttggcttgaatggaaccttggtgacgatgatattggaaat |
50439596 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University