View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20620_high_84 (Length: 238)
Name: NF20620_high_84
Description: NF20620
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20620_high_84 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 113; Significance: 2e-57; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 113; E-Value: 2e-57
Query Start/End: Original strand, 80 - 221
Target Start/End: Original strand, 49736397 - 49736538
Alignment:
| Q |
80 |
aagcaatttgcagagcttcaaatatcacaattcacagagctaaatatcttttatgattcaattgaattattatcaaagcaataataattgaaatgtaata |
179 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49736397 |
aagcaatttgcagagcttcaaatatcagaattcacagagctaaatatcttttatgattcaattgaattattatcaaagcaataataattgaaatgtaata |
49736496 |
T |
 |
| Q |
180 |
tgaaactgaagnnnnnnnctaactaaccttactgggaattct |
221 |
Q |
| |
|
||||||||||| ||||||||||||||| |||||||| |
|
|
| T |
49736497 |
tgaaactgaagaaaaaaactaactaaccttactaggaattct |
49736538 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University