View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20620_high_86 (Length: 238)
Name: NF20620_high_86
Description: NF20620
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20620_high_86 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 35 - 222
Target Start/End: Complemental strand, 9132803 - 9132616
Alignment:
| Q |
35 |
tgaggatgatttaggctgtcatttttcttaaagcacctaaaaggttattgttgttttaaccatatgctttgtactacattatatgataaatttatcagtg |
134 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
9132803 |
tgaggatgatttaggctgtcatttttcttaaagcacctaaaaggttattgttgttttaaccatatgctttgtactacattatatggtaaatttatcagtg |
9132704 |
T |
|
| Q |
135 |
ataaataaaaggataatatgaatgaatcacaatctttttgtgtagatgttgagtagagtgtattgtttttagtttgctaggataaatg |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9132703 |
ataaataaaaggataatatgaatgaatcacaatctttttgtgtagatgttgagtagagtgtattgtttttagtttgctaggataaatg |
9132616 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 35; Significance: 0.00000000008; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 40 - 208
Target Start/End: Complemental strand, 32977627 - 32977463
Alignment:
| Q |
40 |
atgatttaggctgtcatttttcttaaagcacctaaaaggttattgttgttttaaccatatgctttgtactacattatatgataaatttatcagtgataaa |
139 |
Q |
| |
|
|||||||| | || ||||||| || || ||||||||||||||||||||||||| ||||||||| | ||||| | || ||||||||||||||| |
|
|
| T |
32977627 |
atgatttacgatgccattttttttgaatcacctaaaaggttattgttgttttat--atatgctttattgtacatagcagagtatttttatcagtgataaa |
32977530 |
T |
|
| Q |
140 |
taaaaggataatatgaatgaatcacaatctttttgtgtagatgttgagtagagtgtattgtttttagtt |
208 |
Q |
| |
|
|||| ||| ||||| ||||| |||||| |||| | | ||||||||||| ||| |||||||||||||| |
|
|
| T |
32977529 |
taaac--atagtatgactgaataacaatccttttctcttgatgttgagtaaagtatattgtttttagtt |
32977463 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University