View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20620_high_96 (Length: 220)
Name: NF20620_high_96
Description: NF20620
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20620_high_96 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 19 - 220
Target Start/End: Original strand, 4569396 - 4569597
Alignment:
| Q |
19 |
ttaaactcttccaaacactcatccttcacatgaaaacactctctcacaaaaccaccatcatcttcttcatacaccaaaaactctttatccaaactcaaaa |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4569396 |
ttaaactcttccaaacactcatccttcacatgaaaacactctctcacaacaccaccatcaccttcttcatacaccaaaaactctttatccaaactcaaaa |
4569495 |
T |
|
| Q |
119 |
actctcttaccaacgccgaatccactcgtggcacatcccttggacccaacaacttctctctatcccacactggctccaccatgatatgttccccgccacg |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4569496 |
actctcttaccaacgccgaatccactcgtggcacatcccttggacccaacaacttctctctatcccacactggctccaccatgatatgttccccgccacg |
4569595 |
T |
|
| Q |
219 |
ag |
220 |
Q |
| |
|
|| |
|
|
| T |
4569596 |
ag |
4569597 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University