View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20620_high_98 (Length: 216)
Name: NF20620_high_98
Description: NF20620
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20620_high_98 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 17 - 202
Target Start/End: Complemental strand, 43585529 - 43585344
Alignment:
| Q |
17 |
aatatgctaagaaggttttcaagttctatttgcctagataatgaaaccacaccactttgtttctcatatgattacccggataaaataattgatatttcac |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43585529 |
aatatgctaagaaggttttcaagttctatttgcctagataatgaaaccacaccactttgtttctcatatgattacccggataaaataattgatatttcac |
43585430 |
T |
|
| Q |
117 |
aatgattaattctggtgtaatgcatgcaagttgttgtcaattcagtgctacagtcttggaagaggatgagaggggtatactatttg |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43585429 |
aatgattaattctggtgtaatgcatgcaagttgttgtcaattcagtgctacagtcttggaagaggatgagaggggtatactatttg |
43585344 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University