View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20620_low_106 (Length: 205)
Name: NF20620_low_106
Description: NF20620
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20620_low_106 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 142; Significance: 1e-74; HSPs: 4)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 48 - 189
Target Start/End: Original strand, 9166372 - 9166513
Alignment:
| Q |
48 |
acggcttctcccaccacctgcgttgctttctttgtcatctaacttccaatgttcaccaaatgcagcaggaccattatttgctgctttcatcatccatctt |
147 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9166372 |
acggcttctcccaccacctgcgttgctttctttgtcatctaacttccaatgttcaccaaatgcagcaggaccattatttgctgctttcatcatccatctt |
9166471 |
T |
 |
| Q |
148 |
tgatatccatcagcagtctttttcctattattcatcttctct |
189 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9166472 |
tgatatccatcagcagtctttttcctattattcatcttctct |
9166513 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 106; E-Value: 3e-53
Query Start/End: Original strand, 48 - 189
Target Start/End: Original strand, 9154955 - 9155096
Alignment:
| Q |
48 |
acggcttctcccaccacctgcgttgctttctttgtcatctaacttccaatgttcaccaaatgcagcaggaccattatttgctgctttcatcatccatctt |
147 |
Q |
| |
|
||||| ||||||||| ||||||||||| || |||||||||||||||| ||||||||||||||||||||| ||||| |||||||||||||||||||||||| |
|
|
| T |
9154955 |
acggcctctcccaccccctgcgttgctctccttgtcatctaacttcccatgttcaccaaatgcagcaggcccattgtttgctgctttcatcatccatctt |
9155054 |
T |
 |
| Q |
148 |
tgatatccatcagcagtctttttcctattattcatcttctct |
189 |
Q |
| |
|
||||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
9155055 |
tgatatccatcagcagtttttttcctatttttcatcttctct |
9155096 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 1 - 30
Target Start/End: Original strand, 9154896 - 9154925
Alignment:
| Q |
1 |
tcatcttcctctcctttatcagaggaagga |
30 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
9154896 |
tcatcttcctctcctttatcagaggaagga |
9154925 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 1 - 30
Target Start/End: Original strand, 9166313 - 9166342
Alignment:
| Q |
1 |
tcatcttcctctcctttatcagaggaagga |
30 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
9166313 |
tcatcttcctctcctttatcagaggaagga |
9166342 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University