View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20620_low_28 (Length: 445)
Name: NF20620_low_28
Description: NF20620
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20620_low_28 |
 | |
|
| [»] chr1 (2 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 304; Significance: 1e-171; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 304; E-Value: 1e-171
Query Start/End: Original strand, 134 - 445
Target Start/End: Complemental strand, 38605906 - 38605595
Alignment:
| Q |
134 |
gagtttggaactgtgggtcgtgactcgtgaggccaatatgggagaggaattgcacatgtttggccgagttagacaaacccaaattttgcactaggggtgc |
233 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38605906 |
gagtttggaactgtgggtcgtgactcgtgaggccaatatgggagaggaattgcacatgtttggccgagttagacaaacccaaattttgcactaggggtgc |
38605807 |
T |
|
| Q |
234 |
atgcgtaggctgtgacaggtaaaagccctaattttacactgattattcaatagcgagcatagtttgtatgtcggtgttgcatgtgcaatgagatcagtta |
333 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38605806 |
atgcgtaggctgtgacaggtaaaagccctaattttacactgattattcaatagcgagcatagtttgtatgtcggtgttgcatgtgcaatgagatcagtta |
38605707 |
T |
|
| Q |
334 |
attatatagagatctcacatggcacattgcaggcgcggggagggggaggcggaggaatcatgtcgtgtgcaagagagcgaggccctttcttctaaacccg |
433 |
Q |
| |
|
|||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38605706 |
attatatagagatctcacatggcatattgcaggagcggggagggggaggcggaggaatcatgtcgtgtgcaagagagcgaggccctttcttctaaacccg |
38605607 |
T |
|
| Q |
434 |
acccactacact |
445 |
Q |
| |
|
|||||||||||| |
|
|
| T |
38605606 |
acccactacact |
38605595 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 1 - 70
Target Start/End: Complemental strand, 38606040 - 38605971
Alignment:
| Q |
1 |
aaaatcaggttataaatgtaatctaaatataattagaattnnnnnnntaaagaaggataacaaagactta |
70 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
38606040 |
aaaatcaggttataaatgtaatctaaatataattagaattaaaaaaataaagaaggataacaaagactta |
38605971 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 35; Significance: 0.0000000002; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 253 - 357
Target Start/End: Complemental strand, 20498077 - 20497976
Alignment:
| Q |
253 |
taaaagccctaattttacactgattattcaatagcgagcatagtttgtatgtcggtgttgcatgtgcaatgagatcagttaattatatagagatctcaca |
352 |
Q |
| |
|
||||| || |||||||| ||||||| |||||| || ||||||||||||||||| || ||||| ||| ||||||||||| ||| |||||||||||| |
|
|
| T |
20498077 |
taaaaaccataattttaacctgattacgcaatagagaacatagtttgtatgtcggcgtcacatgttcaaagagatcagtta---atacagagatctcaca |
20497981 |
T |
|
| Q |
353 |
tggca |
357 |
Q |
| |
|
||||| |
|
|
| T |
20497980 |
tggca |
20497976 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University