View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20620_low_32 (Length: 403)

Name: NF20620_low_32
Description: NF20620
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20620_low_32
NF20620_low_32
[»] chr1 (2 HSPs)
chr1 (217-269)||(42017846-42017899)
chr1 (32-68)||(42018062-42018098)


Alignment Details
Target: chr1 (Bit Score: 42; Significance: 0.00000000000001; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 217 - 269
Target Start/End: Complemental strand, 42017899 - 42017846
Alignment:
217 aatgttatgatcgttcttgct-tgttcattgttattttcttttaatagtggata 269  Q
    |||||||||||| |||||||| ||||||||||||||||||||||||||||||||    
42017899 aatgttatgatcattcttgctatgttcattgttattttcttttaatagtggata 42017846  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 32 - 68
Target Start/End: Complemental strand, 42018098 - 42018062
Alignment:
32 caacactttgttcattgtatcatcggaagtttgagag 68  Q
    |||||||||||||||||||||||||||||||||||||    
42018098 caacactttgttcattgtatcatcggaagtttgagag 42018062  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University