View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20620_low_54 (Length: 306)
Name: NF20620_low_54
Description: NF20620
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20620_low_54 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 10 - 288
Target Start/End: Complemental strand, 27567451 - 27567171
Alignment:
| Q |
10 |
attattctactattgatgtatgaatcttggtagtggatatccgaccatccattttttagttgtcgttttaaagttaatttatatatata--aagaaatta |
107 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
27567451 |
attattccactattgatgtatgaatcttggtagtggatatccgaccatccattttttagttgtcgttttaaagttaatttatatatatataaagaaatta |
27567352 |
T |
|
| Q |
108 |
attaatcttgtacttttcatgaaattatttacttttgactatatacatttcaccgtttatcatctcattctacccaaacccgaccataggtgggcggtga |
207 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||| |||| ||||||||| |
|
|
| T |
27567351 |
atgaatcttgtacttttcatgaaattatttacttttgattatatacatttcaccgtttatcatctcattctacccaaaccggaccgtaggcgggcggtga |
27567252 |
T |
|
| Q |
208 |
aaactcgaatctctcataaccaaactcatttaaacnnnnnnngcatnnnnnnntagtaacaaattacttagggcagtgtat |
288 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||| |
|
|
| T |
27567251 |
aaactcgaatctctcataaccaaactcatttaaactttttttgcataaaaaaatagtaacaaattacttagggcagtgtat |
27567171 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University