View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20620_low_70 (Length: 258)
Name: NF20620_low_70
Description: NF20620
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20620_low_70 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 11 - 258
Target Start/End: Original strand, 43266891 - 43267138
Alignment:
| Q |
11 |
cacagacccggcgcacatcttcactagccccgcaatgaatccctttattgtagaagcatcaaacggttccctttctttcaatacaaatatctgccataag |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
43266891 |
cacagacccggcgcacatcttcactagccctgcaatgaatccctttattgtagaagcatcaaacggttccctttctttcaatacaaatgtctgccataag |
43266990 |
T |
|
| Q |
111 |
ttagatttttccaatacctttggagtatatttggatggagggtcgttgagggagggaggacttannnnnnnnnnnnnaaattaagtgacagttgtcagtc |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
43266991 |
ttagatttttccaatacctttggagtatatttggatggagggtcgttgagggagggaggacttatttttctttttttaaattaagtgacagttgtcagtc |
43267090 |
T |
|
| Q |
211 |
tgccacatagttagtgtaggataatctgagtttagtgcaggaaaatgt |
258 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43267091 |
tgccacatagttagtgtaggataatctgagtttagtgcaggaaaatgt |
43267138 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University