View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20620_low_72 (Length: 254)
Name: NF20620_low_72
Description: NF20620
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20620_low_72 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 1 - 236
Target Start/End: Original strand, 46735912 - 46736147
Alignment:
| Q |
1 |
ttttagtggtctattaacaatcattttggttgtatattcctcattgtccttatatatcttgttagatgctcttacccaataccataactagttatagcaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46735912 |
ttttagtggtctattaacaatcattttggttgtatattcctcattgtccttatatatcttgttagatgctcttacccaataccataactagttatagcaa |
46736011 |
T |
 |
| Q |
101 |
ctttgaaattcttgacaatgctaccattggaatttgaaagtaacagaaaatgttgaaaagagaaaaggagtatgtaggggttgaaaaatatagaggaata |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||| |
|
|
| T |
46736012 |
ctttgaaattcttgacaatgctaccattggaatttgaaagtaacagaaaatgttgaaaagagaaaaggaggatgtgggggttgaaaaatatagaggaata |
46736111 |
T |
 |
| Q |
201 |
tcaacattaattgatttgatggtttagttatgatgg |
236 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
46736112 |
tcaacattaattgatttgatggtttagttatgatgg |
46736147 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University