View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20620_low_86 (Length: 238)

Name: NF20620_low_86
Description: NF20620
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20620_low_86
NF20620_low_86
[»] chr1 (1 HSPs)
chr1 (80-221)||(49736397-49736538)


Alignment Details
Target: chr1 (Bit Score: 113; Significance: 2e-57; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 113; E-Value: 2e-57
Query Start/End: Original strand, 80 - 221
Target Start/End: Original strand, 49736397 - 49736538
Alignment:
80 aagcaatttgcagagcttcaaatatcacaattcacagagctaaatatcttttatgattcaattgaattattatcaaagcaataataattgaaatgtaata 179  Q
    ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
49736397 aagcaatttgcagagcttcaaatatcagaattcacagagctaaatatcttttatgattcaattgaattattatcaaagcaataataattgaaatgtaata 49736496  T
180 tgaaactgaagnnnnnnnctaactaaccttactgggaattct 221  Q
    |||||||||||       ||||||||||||||| ||||||||    
49736497 tgaaactgaagaaaaaaactaactaaccttactaggaattct 49736538  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University